
EURL
European Union Reference Laboratory for
Foot-and-Mouth disease

LRUE Fièvre Aphteuse
The European Union Reference Laboratory organises Proficiency Tests (PTs) on detection and typing of Foot-and-Mouth disease virus in accordance with the Regulation (EU) No 2017/625.
PT panels for FMDV and SVDV detection are established for virus isolation, RT-PCR, Antigen-ELISA and VP1 sequencing. PT panels for FMD antibody detection are established for FMDV NSP antibodies, FMDV SP antibodies and SVDV antibodies detection by ELISAs or/and virus neutralisation test.
The proficiency test (PT) for FMD virus and SVD virus and antibody detection is organised annually. All EU national reference laboratories (NRLs) and other official laboratories of the network are invited to participate.
The European Union Reference Laboratory yearly organizes a workshop, especially intended for the EU national reference laboratories (NRLs) and other official laboratories of the network.
The purpose of these workshops is to inform the participants about the activities of the EURL, to present and discuss the results of the PT, to present and discuss scientific research projects and to exchange information on EU legislation, methods and other relevant subjects.
The EURL for FMD, among other missions, gathers data and information on the methods of diagnosis and differential diagnosis used in the different National Laboratories.
A list of methods inspired by the WOAH official methods is available on this website.
The EURL for FMD supports the functions of National Laboratories by storing and supplying reagents and materials for use in diagnosis of foot-and-mouth disease such as virus and/or inactivated antigens, standardised sera, cell lines and other reference reagents.
A list of reagents and material is available on this website.
The European Union Reference Laboratory organizes each year trainings specifically intended for the EU national reference laboratories (NRLs) and other official laboratories of the network.
The purpose of these sessions is to implement the further training of experts in laboratory diagnosis with the goal to harmonize the diagnostic techniques at the European and International levels.
List of Foot-and-mouth disease reagents available at the WRL the Pirbright Institute can be found here.
2025 Proficiency test on Foot and Mouth Disease
Test reports:
► Online test report for panel 1,
► Online test report for panel 2,
► Online test report for panel 3,
Beware that the test reports are not linked with leila. Therefore be careful to keep the link you will get to be able to come back and modify your entries.
Nevertheless once validated you will not be able to modify your test report(s).
Keep in mind that you need to upload the test reports joint in a zip-file in leila website.
An outbreak of Foot-and-Mouth Disease has been reported in Slovakia in domestic cattle for the first time in 50 years. Cases have been detected in three farms located in the southern part of the country. This is the third case in the EU in 2025 after the outbreaks in Germany in January and in Hungary in March. Restriction zones have been set up around the farms. The identification of the serotype is pending.
For more information: Slovakia records first foot-and-mouth cases, minister says | Reuters; WAHIS
An outbreak of Foot-and-Mouth Disease has been reported in Hungary in domestic cattle. The outbreak is located in the North-west of the country in the administrative zone of Győr-Moson-Sopron. This is the second case in the EU in 2025 after the outbreak in Germany in January. Restriction zones have been set up around the outbreak and animals have been slaughtered. Following sequencing, the strain responsible for the infection was identified : O/ME-SA/PanAsia2/ANT10.
For more information: https://portal.nebih.gov.hu/-/megjelent-a-ragados-szaj-es-koromfajas-betegseg-magyarorszagon; WAHIS
This real-time RT-PCR is a molecular tool for detection of Foot-and-mouth disease virus lineage O/ME-SA/SA-2018, as it is an emerging lineage in South Asia since 2018.
This real-time RT-PCR is a molecular tool for detection of Foot-and-mouth disease virus lineage O/ME-SA/SA-2018, as it is an emerging lineage in South Asia since 2018. The assay has been tested on 34 FMDV positive samples (including 12 SA-2018 samples) with a specificity of 91,7% (11/12 SA-2018 samples detected). The primers and probes are indicated hereafter:
Oligo name (final concentration) |
Sequence (5’-3’) |
Use |
SA2018_F3 (0.4 μM) |
ACAACACCACCAATCCAAC |
Forward Primer |
SA2018_P3 (0.3 μM) |
FAM-ACTCACCCGACTTGCACTGCCGT-TAMRA |
Probe |
SA2018_Rev2 (0.4 μM) |
CGTTGTAAACAGTAGCCATGA |
Reverse Primer |
The SA-2018 has been validated using Ag-Path kit in a duplex system with β-actin, and following the volumes and concentrations as follow (5 µl of RNA):
|
Volume (µl) |
Concentration |
||
|
For one tube |
Initial |
Final |
|
Ultrapure water (DNase RNase Free) |
1,15 |
/ |
||
Buffer 2X (kit AgPath-ID™) |
12,5 |
2 |
1 |
X |
Primer F |
1 |
10 |
0,4 |
µM |
Primer R |
1 |
10 |
0,4 |
µM |
Probe FAM-TAMRA |
0,75 |
10 |
0,3 |
µM |
Primer F β-actine |
1 |
10 |
0,4 |
µM |
Primer R β-actine |
1 |
10 |
0,4 |
µM |
Probe VIC-TAMRA β-actine |
0,6 |
5 |
0,12 |
µM |
RT-PCR mix 25X (Enzyme) |
1 |
25 |
1 |
X |
Real-time PCR program:
Cycles of RTq-PCR |
||
T° |
Time |
nb cycles |
45°C |
10min |
1 |
95°C |
10min |
1 |
95°C |
15s |
45 |
62°C |
1min |
NB: This system has been validated on a small number of samples and should therefore be tested against other samples from this lineage.
An outbreak of Foot-and-Mouth Disease has been reported in Germany in water buffaloes. The outbreak is located in the Brandenburg region, close to Berlin (first reports of this disease in Germany since 1988). This is the first case in the EU since 2011 in Bulgaria. According to the regional authorities, three water buffaloes are confirmed as infected. Restriction zones have been set up around the outbreak. The identification of the serotype is pending.
For more information: https://wahis.woah.org/#/in-review/6177 ; https://www.fli.de/en/news/short-messages/short-message/fli-confirms-foot-and-mouth-disease-in-brandenburg-water-buffalo/
As part of its WOAH and FAO mandates, the EURL for FMD took part in the Regional Advisory Group (RAG) meeting dedicated to Foot and Mouth Disease (FMD) and Peste des Petits Ruminants (PPR). The meeting, organized by WOAH and FAO, took place from July 2 to 4, 2024 in Baku, Azerbaijan. Several delegations took part in the meeting (Azerbaijan, Georgia, Iran, Kazakhstan, Kyrgyzstan, Uzbekistan and Russia), as did WOAH and FAO officials associated with the region, and the European Commission for the Control of Foot-and-Mouth Disease (EuFMD). The EURL was represented by Guillaume Girault, project leader in the Biopic team, who presented recent foot and mouth disease events and outbreaks observed around the world, with a particular focus on outbreaks detected in Western Eurasia in recent years. Numerous exchanges took place concerning the two diseases covered by this meeting. A field simulation exercise was also carried out by the Azeri veterinary services, with the deployment of mobile laboratories, surveillance of wildlife using drones, and the setting up of a crisis unit. The participation of the Foot and Mouth Disease EURL at this meeting enabled contacts to be established with several colleagues from other countries, opening the door to potential future collaborations.